High altitude is a significant stressor on the human body and carries with it the potential to harm the body and impact one’s ability to survive. The higher the altitude the lower the air pressure makes it challenging to breathe; placing this into its proper perspective; the typical percentages of oxygen are about 30%lower than normal sea level at a higher altitude. Over increased time of oxygen deprivation (hypoxia), the body starts exhibiting the symptoms of severe stress dislodging ones homeostasis: headache, vomiting and distorted vision can even occur. If the body is not returned to normal air pressure levels within a few days death can occur from pulmonary edema or cerebral edema. These symptoms of stress are even more vigorous and create a more certainty of death when increased/decreased altitudes are done to rapidly.

 In the immediate or Short-term adaptations our bodies develop responses to oxygen deprivation; these involuntary responses consist of labored breathing, heart rate increases, and blood pressure increases. This is the body’s way of trying to get more oxygen to the lungs and cells of the body to allow for continuation of mobility and functionality, without enough oxygen the blood can become toxic to organs that it is failing to supply oxygen too. There is also a more rapid evaporation of moisture from your skin and from your lungs; higher altitudes have low humidity which can speed up evaporation. Keeping hydrated in this environment is also very important to keeping your body functioning.

Another good example of human’s ability to adapt is that of athletes training at higher elevations to condition their bodies. This is considered a Facultative adaptation in that the lungs of the athlete actually begin to expand and get larger over time of practicing this training method. In addition, as the lung increase to better adapt to the accumulation of gasses, the red blood cell production increases as well as capillary production. This is done in order to give the athlete an edge in competition on sea level because his/her body is now able to temporarily deal with the buildup of fatigue better, this lasts a few weeks and then returns to normal. One’s ability to adapt to this is remembered by the body and easily attainable again and again. However, this is not a genetic trait that gives this ability its momentum. This gives the athletes a competitive edge, once they return to sea level. The effects of this high altitude training return to normal in just a matter of weeks. 

As for any developmental adaptations those that reside in higher altitudes and choose to make a permanent home in the area have genetically changed over thousands of years to better, permanently adapt. The Himalayas not only have extreme altitude but those who live there have been studied and found to have  two additional oxygen-processing genes that aren’t found in populations of those at normal sea levels. In addition. They also seem to have larger blood vessels in which to quickly carry the oxygenated blood throughout the body, making them more adaptive to this specific environment.

Due to the fact that the Himalayas present an intrigue to those seeking an adventure, people have adapted to the low oxygen levels simply by just carrying oxygen with them on their adventures up the mountains. Had cultural phenomena of being on top, and challenging one’s self not been in place, no one would need to have the oxygen in the first place. However, the need for oxygen supplementation does not end there as it it also used in the cultural need to travel and possibly even visit long lost relatives. People have the need currently to travel into higher altitudes that are insufficient in oxygen, because of this technology and ingenuity have come together to adapt devices to solve the problem.
Some of the benefits to living in higher elevations is the conditioning of the heart, and the previously noted athletic advantage (for those that return to normal level). There are published findings that show people living at higher elevations are less likely to die from certain types of heart disease, because of this and many other reason those living in higher elevations; with the proper adaptations have a longer life expectancy.

In order to better understand the adaptations in higher altitudes, those that are closely related to the Tibetan people that reside in the Himalayas could be studied. However, this would yield you little to compare. When the Tibetan DNA was compared to low-land Chinese and Japanese populations the gene variants associated with the high altitude living were not found in their low altitude living relatives. Race relations are not an adequate replacement to studying adaptations because it does not take into account the environmental factors. Studying the environmental influences while also taking into account those closely related racially, would be a better way; leading to the potential understanding of human variation. One needs to be able to compare and contrast genetics and environmental stimulus to get the whole picture as to why populations vary.

 Part I

Trying to stay engaged in a conversation where you are not allowed to speak Write or talk is difficult, however it was made easier by the ability to still show interest in a conversation with my body language. I wouldn’t say that the friend I was engaging with was very put off by what I was doing; rather she was very impressed that I was able to appear to be listening to her ramble off a story without my usual interruptions. I simply smiled when I was in agreement, made confused face when I felt I needed more explanation, gave looks of disapproval when I didn’t agree and made facial expressions of surprise to show intrigue. Surprisingly the conversation was manageable and lasted through the fifteen minutes and beyond.

If we were two different cultures meeting for the first time the speaking group has the advantage in communicating complex ideas because they can use words and gestures. The speaking culture in its attempt to convey a message might feel that the others do not necessarily understand, or rather understand to the degree and complexity in which they would like. The speaking group may find the others to be inferior to themselves, and a bit on the fundamental side. I would make an argument that the speaking group would not really bother in the attempt to communicate much further, rather would attempt to teach or give up entirely.

I do find it truly fascinating that when one feels another doesn’t understand we begin to start breaking up our language and substitute allot more gesturing and body language; somehow we might also feel the need to raise out voice as if the understanding would be better louder and dummied  down. Those that might have trouble communicating in our culture would be those that are of other cultures that have not learned the language to it fullest extent. This affects they way that they are or are not dealt with in our culture; I know that when I have customers come into my store and they do not speak English that I tend to ignore them until they make an exaggerated effort to explain themselves. This is not typical as my store operates on an excessive amount of communication and customer service. This affects my overall effort and demeanor toward that individual, and despite my best attempt to stray from avoidance I cannot as I do this naturally.

 Part II

During this limitation I was able to last the full fifteen minutes, although I think this is because I had a willing participant and a few different attempts. This experiment was difficult in that I never realized just how expressive my face is. There was many times that my partner had to stop me in the beginning and tell me that I was raising an eyebrow or gesturing with my hands. I generally am a pretty talkative person and I tend to communicate and gesture allot with mu hands as well, standing there stiff as a board was challenging. Those that participated in this experiment did not seem to enjoy talking to me and we found it difficult to continue on a conversation. I cant really place into words the effect that limiting language to just the spoken word has. It doesn’t seem to allow for the human element, whatever that may be, to engage well and captivate the others in the group.

I would have to say that based on this experiment, “sign” language is probably more fundamental that verbal or written. It is almost impossible to verbally explain how sad or happy you are in a conversation without bodily gestures or “signs”. And when the verbal word cannot be found for something, there is nothing else to gravitate to; when someone doesn’t understand you in conversation you can show them examples in other ways to convey the message. Removing this is devastating to communication.

The adaptive benefit to possessing the ability to read body language is evident, you can better communicate. In addition you have more potential to attract others in a group setting or mate if you act similarly in your gestures of emotions. In addition, the ability to read body language of others is extremely important in safety; knowing when to avoid an individual that is just not fitting in or feeling right to you can save your life. The best environment to give example of this is if you were in a strange neighborhood and someone was across the street, if they are displaying aggression you know to run the other way. If the person across the street is displaying concern you might be able to receive help or get a better understanding of where you are and what to expect. The ability to communicate is vital to our existence, but one must never underestimate the power of body language as it is fundamental to all animal life.  

                 An archaeological discovery in 1912 by Charles Dawson, who was digging at a sight dated to be 1myo, in Piltdown, England; found a piece of a skull, this finding led to many others on the part of Dawson. However, it all ended 40 years later as a hoax and was proven to be a complete fabrication, a scientific falsity in 1953. Unfortunately for the scientific community, the original finding of the piece of skull was celebrated and dubbed a new species of early man. The British academic establishment wanted nothing more but to believe in the “Piltdown man” as they were sadly lacking in ancient findings of fossils.  Until Dawson, most of the important discoveries of early man had come from Germany, Asia and Africa. 

               Over the years, Dawson submitted other finds and was thought to be someone who “had a great eye for collecting things”. After a while it did become quite evident that the fossils derived from Africa and Asia did not show the same patterns of development as the Piltdown man, this began to raise some questions but at the time Dawson and his team were thought of as gentleman and top of their class scholars, not to be questioned.

               It wasn't until Joseph Weiner, a S. African anthropologist, used a magnifying glass to look at the teeth in the jaw bone and saw scratch marks that were obviously from someone using a file to wear down the teeth. The incisors were made to a smaller scale and the fossils seem to have been died and manipulated to have both human and ape characteristics. Shortly after WWII, the fossils were dated using a new technology of measuring fluorine absorption, as well as the measurement of nitrogen. The fluorine test indicated that the fossil was between 100,000 years old; this contradiction launched a full scale analysis in 1959.  Radiocarbon tests were performed and showed the human cranium to be only about 600 years old and the jaw 500 years old. These are great examples of the positive influences of scientific testing, being able to falsify a claim.

               The scientific academic community was stunned; it reflected negatively on their credibility that the "Piltdown man" escaped detection. Although, the reasoning for this (escaping detection); seemed to be the limited accessibility to the fossils for any substantial length of time. Arthur Smith Woodward was the keeper of geology at the British Museum at the time; He was the most respected authority in paleontology and was the one that controlled access to the fossils. It is speculated that, had other scientists been able to examine them more closely, perhaps they would have seen that the fossils had been tampered with. 

               The lessons that were learned in this hoax were simply that the honor system does not mix with science. “Good science depends on objectivity to prevent lies”, this is simply true because distracting oneself on someone’s reputation, therefore not questioning the science, does not make for good researched or tested fats of science. Human factor will always be a part of science; humans are the ones that begin to ask the questions that prompt evaluation of science to begin with; Scientists will always have the potential of being dishonest this is why we have established a great system on peer review. It is pretty difficult and highly scrutinized to make something a scientific theory or for a scientist to draw a conclusion on an artifact. This is why critical thinking and asking critical questions are so important, if one never looked in a magnifying glass or took a closer look at what is presented, one might be believing a lie.  

-Maria Hernandez

Lemurs

Smallest species primarily consume fruit and insects, while the larger species lean more toward an herbivores diet, consuming mostly plant material. Many lemurs that eat leaves tend to do so during times of fruit scarcity, sometimes suffering weight loss as a result. Some Lemurs have also developed the ability to chew through seeds, these seeds are quite hard and many monkeys have had issues eating in the past.

Three of the five species utilize different dietary patterns and their underlying physiological traits to allow them to coexist: fork-marked lemurs feed on tree gum, sportive lemurs feed on leaves, and giant mouse lemurs sometimes feed on insect secretions. The other two species, the gray mouse lemur and the fat-tailed dwarf lemur, avoid competition through reduced activity. The gray mouse lemur uses stages of intentional inactivity, while the fat-tailed dwarf lemur hibernates totally.

The variation in feed preference and lifestyle is due to the fact that Madagascar, where lemurs live, not only contains two radically different climates; the rain-forests (east) and the dry regions (west), but also lemurs are made to deal with extended drought to floods. Lemurs spend most of their time in the trees their as there environmental extremes call for safety in the trees, lemurs are made to endure.

Spider Monkey

The diets of spider monkeys consist of mostly fruits and nuts however, if food is scarce, they will eat insects and insect larvae, bark and honey. They also tend to feed on young leaves, flowers, roots and on occasion bird eggs. Although it is rare, some spider monkeys have been known to eat small animal prey. (Omnivorous)

Spider Monkeys can be found in the tropical rain forests of Central and South America, from southern Mexico to Brazil. Because of their environment spider monkeys are usually found in the upper canopies of the rain forests they inhabit. Spider Monkeys eat while hanging, climbing or moving, they thrive in the evergreen and mangrove forests and almost never come down to ground level. 

Baboon

Baboons are opportunistic omnivores and selective feeders that carefully choose their food. Grass makes up a large part of their diet, along with berries, seeds, pods, blossoms, leaves, roots, bark and sap from a variety of plants. Baboons also eat insects and small quantities of meat, such as fish, shellfish, hares, birds, and sometimes slammer monkeys; they have also been known to eat young small antelopes.

 Baboons are found in a surprisingly varied habitat and are extremely adaptable. The major requirements for any habitat seem to be a water sources and safe sleeping places in either tall trees or on cliff faces. 

Gibbons

Gibbons thrive on the abundant fruit trees in their tropical range in Southeast Asia, and are especially fond of figs. They will occasionally supplement their diet with leaves, insects, leaves, flowers, seeds, tree bark and tender plant shoots. They have also been seen eating spiders, bird eggs and small birds.  

Gibbons have quite an advantage of being able to swing out and grab fruits growing at the end of branches, which limits competition for their favorite foods. They also do not have any natural predators in their environment as they are extremely difficult to catch.

Chimpanzee

Chimpanzees live in a wide variety of habitat types that includes dry savannas, evergreen rain-forests, swamp forests, and dry woodland. To live across such different habitat types, chimpanzees must be quite adaptable, just as the Baboon (and many others).

The chimpanzee diet consists mainly of fruit, but they also eat leaves and leaf buds, and the remaining part of their diet consists of a mixture of seeds, blossoms, stems, pith, bark and resin Chimpanzees are highly preferential to eating fruit, even when it is not abundant. They supplement their mainly vegetarian diet with insects, birds, birds' eggs, honey, soil, and small to medium-sized mammals (including other primates). They spend about seven hours a day eating, though chimpanzees love fruit they also especially like termites, these termites provide the most nutrition for them, they still prefer fruit (i.e. I think they just like the work/activity of getting the termites out of the mound). It is interesting to note that since chimps do eat bird eggs and hunt chicks/ birds they generally will hunt in a group, it seems as though they are aware that success is a cooperative effort.  

Summary

In my findings I will conclude, all the animals reviewed are under enormous environmental pressures and competition as their habitats are disappearing at an alarmingly rapid rate. This aside, the common traits that seems to be passed is the ability to be omnivorous. This trait seems to be more quantitative in nature as it is highly affected by the environmental factors as well as it (diet) has continuous distributions, not just too discrete classes and it is a trait that is affected by many genes. Every listed animal above would prefer to be vegetarian in nature; however, whether it is due to extreme drought or availability, their living conditions have pushed the boundaries of what they are able to process as nutrition. In the end the animals above are all omnivores, regardless of their food preference.    

-Maria Hernandez

Homologous: It is easier to see visually, if you take the image of the Bat and the Human, that these animals have two different adaptations. The bat uses its forelimb for flight and we use our arm in a completely different manner (i.e. pick things up).Humans and bats are two different animals visually however, both fit under the category of vertebrates. The structure that is passed on here is the skeletons of the two animals. All vertebrates have skeletons because their ancestors had skeletons and passed the trait (i.e. the bat still visually shows all five digits just as the human limb does.)  Both the Human and the bat are in the class of Mammals, this alone suggests that the two are related; also, mammals are practically identical at the pre-embryonic stage, if the two were not of an ancestral relation they would not exhibit this trait either. This (somewhat) proves that bats and humans come from common ancestry. We know that the ancestor had to have possessed these traits (vertebrae) in order to have passed it on, or it would have looked more analogous in nature as opposed to a deviation of an identical vertebral trait. Humans and bats, as well as many other mammals have the same forearms with the exact same bones just with an alteration in function. If they were not homologous ancestors they would not share this same trait, let alone have the same forearm bones. The exact answer to what ancestor they both have in common is unknown to me but through some research some have said a “tree shrew”. According to how our book breaks this down, they are simply very distant cousins of one another.

   

Analogous: One could look at a bird and a butterfly for describing an analogous trait as the two both share the feature of flight and yet are not ancestors of one another in the definition of passing on this trait genetically. Insect wings lack bones rather use fluid pressure or some other mechanism to move the wing and allow for flight. The bird has the same bones of a forearm and the qualities of mammals in the structure of bones, which allow for the movement of its wings. Insects tend to have four sets of wings where as a bird only has a single set. The wings of the butterfly are scale like in nature and the wings of the bird have feathers; yet both are adapted to their environment through the use of flight. In this respect both have solved the need to get off the ground in the same way. Although the bird wings do look superficially similar to that of the butterfly the anatomical make up is totally different. The traits are Analogous because there is no known ancestral history.

-Maria Hernandez

DNA code:
ATGTTAAGGGAACGTAACAAGTACGTGCAAA

Blog Post 1: Charles Lyell

Maria Hernandez

Anthropology

08/29/213

     Charles Lyell was a Geologist that became most famous after his book “principles of Geology” which explained that the changes in the earth that we see today were caused by geological change long ago. Also, that this change is constantly driven by the consistent forces of nature that one can see today. Emphasizing that little change can be immense over a long period of time. He was named to have changed the time frame in which the earth was viewed, taking earth from a few thousand years old to millions. In addition to this, Lyell was said to be “obsessed with the implications of evolution,” while ranting about evolution he made know to the English speaking world J.B Lamarck (french). Lamarck’s belief in the ability for species to change was just another step for Darwin on his discovery of natural selection rather than Lamarck’s idea of spontaneous change. If Charles Lyell was not so against the idea that man was just a “better beast” then he probably would not have opened the eyes of others to the notions of Lamarck, that intern also influenced Darwin.“ For example, the often heard remark that Lamarck believed that a giraffe's neck was long because each generation stretched its neck to reach higher branches and passed on its stretched neck to its offspring, is a mocking example from Lyell, not from Lamarck himself.”                One of the concepts of evolution is, if the environment changes, the traits that are helpful or adaptive to that environment will be different. Lyell gave father to the notion of mountains and rivers and so on change consistently over a long span of time. According to Lyell, this change is considered to him to be constant because the “underlying processes” are constant. Therefore, if the environment is constantly changing, animals have no choice to adapt. If there were no adaptation in animals and the environment constantly changes the earth would be deserted of life.

Another key facet of evolution is that individuals do not evolve. Populations do. Evolution does not occur within a generation. It occurs between generations. Lyell is in sense the father of time, inventing the concept of “deep Time”. Because his work allowed for the time needed to erect change. It transfers nicely to the time needed to change populations. It would be less easy to accept evolution if change was immediate.  

 Science and theory itself is hardly ever the work of one sole individual, it takes many to build an idea or to inspire a new way of thinking. Charles Lyell is cited mostly for changing the concept of “deep time,” as the course book calls it. This allowed for a possibility of evolution, giving millions of years of information and ideas to work with.  Without this discovery, evolution would have been too big a pill to swallow. It would have bordered impossible, trying to explain all the different species evolving in only a few thousand years.  Lyell broadened the scope in which one could think more freely and open mindedly about the possibility of evolution.5.The church clearly was opposed to the idea of evolution because that meant that it would alter their way of teaching god and his position of making things as they are, and are meant to be. Put in a better way, natural selection is not natural or divine design. Clearly Darwin was valid in keeping his thoughts of evolution to himself were valid, not publishing anything until he felt his hand forced by Wallace. However, despite the church and the commonly held belief that evolution was form atheism, Darwin released his book and it was well received by the scientific community. This was a saving grace (so to speak) because out casting yourself from the church and the majority of society, one would hope to have made headway with one’s own peers. 

Work cited

http://www.victorianweb.org/science/lyell.html

http://www.victorianweb.org/science/lamarck1.html