An archaeological discovery in 1912 by Charles Dawson, who was digging at a sight dated to be 1myo, in Piltdown, England; found a piece of a skull, this finding led to many others on the part of Dawson. However, it all ended 40 years later as a hoax and was proven to be a complete fabrication, a scientific falsity in 1953. Unfortunately for the scientific community, the original finding of the piece of skull was celebrated and dubbed a new species of early man. The British academic establishment wanted nothing more but to believe in the “Piltdown man” as they were sadly lacking in ancient findings of fossils.  Until Dawson, most of the important discoveries of early man had come from Germany, Asia and Africa. 

               Over the years, Dawson submitted other finds and was thought to be someone who “had a great eye for collecting things”. After a while it did become quite evident that the fossils derived from Africa and Asia did not show the same patterns of development as the Piltdown man, this began to raise some questions but at the time Dawson and his team were thought of as gentleman and top of their class scholars, not to be questioned.

               It wasn't until Joseph Weiner, a S. African anthropologist, used a magnifying glass to look at the teeth in the jaw bone and saw scratch marks that were obviously from someone using a file to wear down the teeth. The incisors were made to a smaller scale and the fossils seem to have been died and manipulated to have both human and ape characteristics. Shortly after WWII, the fossils were dated using a new technology of measuring fluorine absorption, as well as the measurement of nitrogen. The fluorine test indicated that the fossil was between 100,000 years old; this contradiction launched a full scale analysis in 1959.  Radiocarbon tests were performed and showed the human cranium to be only about 600 years old and the jaw 500 years old. These are great examples of the positive influences of scientific testing, being able to falsify a claim.

               The scientific academic community was stunned; it reflected negatively on their credibility that the "Piltdown man" escaped detection. Although, the reasoning for this (escaping detection); seemed to be the limited accessibility to the fossils for any substantial length of time. Arthur Smith Woodward was the keeper of geology at the British Museum at the time; He was the most respected authority in paleontology and was the one that controlled access to the fossils. It is speculated that, had other scientists been able to examine them more closely, perhaps they would have seen that the fossils had been tampered with. 

               The lessons that were learned in this hoax were simply that the honor system does not mix with science. “Good science depends on objectivity to prevent lies”, this is simply true because distracting oneself on someone’s reputation, therefore not questioning the science, does not make for good researched or tested fats of science. Human factor will always be a part of science; humans are the ones that begin to ask the questions that prompt evaluation of science to begin with; Scientists will always have the potential of being dishonest this is why we have established a great system on peer review. It is pretty difficult and highly scrutinized to make something a scientific theory or for a scientist to draw a conclusion on an artifact. This is why critical thinking and asking critical questions are so important, if one never looked in a magnifying glass or took a closer look at what is presented, one might be believing a lie.  

-Maria Hernandez

Lemurs

Smallest species primarily consume fruit and insects, while the larger species lean more toward an herbivores diet, consuming mostly plant material. Many lemurs that eat leaves tend to do so during times of fruit scarcity, sometimes suffering weight loss as a result. Some Lemurs have also developed the ability to chew through seeds, these seeds are quite hard and many monkeys have had issues eating in the past.

Three of the five species utilize different dietary patterns and their underlying physiological traits to allow them to coexist: fork-marked lemurs feed on tree gum, sportive lemurs feed on leaves, and giant mouse lemurs sometimes feed on insect secretions. The other two species, the gray mouse lemur and the fat-tailed dwarf lemur, avoid competition through reduced activity. The gray mouse lemur uses stages of intentional inactivity, while the fat-tailed dwarf lemur hibernates totally.

The variation in feed preference and lifestyle is due to the fact that Madagascar, where lemurs live, not only contains two radically different climates; the rain-forests (east) and the dry regions (west), but also lemurs are made to deal with extended drought to floods. Lemurs spend most of their time in the trees their as there environmental extremes call for safety in the trees, lemurs are made to endure.

Spider Monkey

The diets of spider monkeys consist of mostly fruits and nuts however, if food is scarce, they will eat insects and insect larvae, bark and honey. They also tend to feed on young leaves, flowers, roots and on occasion bird eggs. Although it is rare, some spider monkeys have been known to eat small animal prey. (Omnivorous)

Spider Monkeys can be found in the tropical rain forests of Central and South America, from southern Mexico to Brazil. Because of their environment spider monkeys are usually found in the upper canopies of the rain forests they inhabit. Spider Monkeys eat while hanging, climbing or moving, they thrive in the evergreen and mangrove forests and almost never come down to ground level. 

Baboon

Baboons are opportunistic omnivores and selective feeders that carefully choose their food. Grass makes up a large part of their diet, along with berries, seeds, pods, blossoms, leaves, roots, bark and sap from a variety of plants. Baboons also eat insects and small quantities of meat, such as fish, shellfish, hares, birds, and sometimes slammer monkeys; they have also been known to eat young small antelopes.

 Baboons are found in a surprisingly varied habitat and are extremely adaptable. The major requirements for any habitat seem to be a water sources and safe sleeping places in either tall trees or on cliff faces. 

Gibbons

Gibbons thrive on the abundant fruit trees in their tropical range in Southeast Asia, and are especially fond of figs. They will occasionally supplement their diet with leaves, insects, leaves, flowers, seeds, tree bark and tender plant shoots. They have also been seen eating spiders, bird eggs and small birds.  

Gibbons have quite an advantage of being able to swing out and grab fruits growing at the end of branches, which limits competition for their favorite foods. They also do not have any natural predators in their environment as they are extremely difficult to catch.

Chimpanzee

Chimpanzees live in a wide variety of habitat types that includes dry savannas, evergreen rain-forests, swamp forests, and dry woodland. To live across such different habitat types, chimpanzees must be quite adaptable, just as the Baboon (and many others).

The chimpanzee diet consists mainly of fruit, but they also eat leaves and leaf buds, and the remaining part of their diet consists of a mixture of seeds, blossoms, stems, pith, bark and resin Chimpanzees are highly preferential to eating fruit, even when it is not abundant. They supplement their mainly vegetarian diet with insects, birds, birds' eggs, honey, soil, and small to medium-sized mammals (including other primates). They spend about seven hours a day eating, though chimpanzees love fruit they also especially like termites, these termites provide the most nutrition for them, they still prefer fruit (i.e. I think they just like the work/activity of getting the termites out of the mound). It is interesting to note that since chimps do eat bird eggs and hunt chicks/ birds they generally will hunt in a group, it seems as though they are aware that success is a cooperative effort.  

Summary

In my findings I will conclude, all the animals reviewed are under enormous environmental pressures and competition as their habitats are disappearing at an alarmingly rapid rate. This aside, the common traits that seems to be passed is the ability to be omnivorous. This trait seems to be more quantitative in nature as it is highly affected by the environmental factors as well as it (diet) has continuous distributions, not just too discrete classes and it is a trait that is affected by many genes. Every listed animal above would prefer to be vegetarian in nature; however, whether it is due to extreme drought or availability, their living conditions have pushed the boundaries of what they are able to process as nutrition. In the end the animals above are all omnivores, regardless of their food preference.    

-Maria Hernandez

Homologous: It is easier to see visually, if you take the image of the Bat and the Human, that these animals have two different adaptations. The bat uses its forelimb for flight and we use our arm in a completely different manner (i.e. pick things up).Humans and bats are two different animals visually however, both fit under the category of vertebrates. The structure that is passed on here is the skeletons of the two animals. All vertebrates have skeletons because their ancestors had skeletons and passed the trait (i.e. the bat still visually shows all five digits just as the human limb does.)  Both the Human and the bat are in the class of Mammals, this alone suggests that the two are related; also, mammals are practically identical at the pre-embryonic stage, if the two were not of an ancestral relation they would not exhibit this trait either. This (somewhat) proves that bats and humans come from common ancestry. We know that the ancestor had to have possessed these traits (vertebrae) in order to have passed it on, or it would have looked more analogous in nature as opposed to a deviation of an identical vertebral trait. Humans and bats, as well as many other mammals have the same forearms with the exact same bones just with an alteration in function. If they were not homologous ancestors they would not share this same trait, let alone have the same forearm bones. The exact answer to what ancestor they both have in common is unknown to me but through some research some have said a “tree shrew”. According to how our book breaks this down, they are simply very distant cousins of one another.

   

Analogous: One could look at a bird and a butterfly for describing an analogous trait as the two both share the feature of flight and yet are not ancestors of one another in the definition of passing on this trait genetically. Insect wings lack bones rather use fluid pressure or some other mechanism to move the wing and allow for flight. The bird has the same bones of a forearm and the qualities of mammals in the structure of bones, which allow for the movement of its wings. Insects tend to have four sets of wings where as a bird only has a single set. The wings of the butterfly are scale like in nature and the wings of the bird have feathers; yet both are adapted to their environment through the use of flight. In this respect both have solved the need to get off the ground in the same way. Although the bird wings do look superficially similar to that of the butterfly the anatomical make up is totally different. The traits are Analogous because there is no known ancestral history.

-Maria Hernandez

DNA code:
ATGTTAAGGGAACGTAACAAGTACGTGCAAA